ID: 1067440578_1067440587

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1067440578 1067440587
Species Human (GRCh38) Human (GRCh38)
Location 10:46307174-46307196 10:46307226-46307248
Sequence CCAGGATGGTGACACCAAGCAGC ATGGCATGAGACCCCATGCAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 35, 4: 729}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!