ID: 1067474378_1067474397

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1067474378 1067474397
Species Human (GRCh38) Human (GRCh38)
Location 10:46556461-46556483 10:46556507-46556529
Sequence CCCGCCCCAACGGGAGCGCGCGG CGCCGGGGCCGCGCAGGCGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 75, 4: 520}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!