ID: 1067495298_1067495308

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1067495298 1067495308
Species Human (GRCh38) Human (GRCh38)
Location 10:46756147-46756169 10:46756180-46756202
Sequence CCAGTCCCCACCCTCCTAGGGTC CATCTCATCATGTGTTTTGAGGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 3, 3: 41, 4: 315} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!