ID: 1067519068_1067519072

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1067519068 1067519072
Species Human (GRCh38) Human (GRCh38)
Location 10:46981400-46981422 10:46981445-46981467
Sequence CCTGGCTACAGCTGCTACTGAGT ACCAACACTGAGTACCTGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 11, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!