ID: 1067528141_1067528152

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1067528141 1067528152
Species Human (GRCh38) Human (GRCh38)
Location 10:47050725-47050747 10:47050762-47050784
Sequence CCACTCCCCTCTCCTCCTCCTCA TCCAAGGAAGCTGCTGAGATAGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 113, 3: 1048, 4: 6730} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!