ID: 1067544587_1067544601

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1067544587 1067544601
Species Human (GRCh38) Human (GRCh38)
Location 10:47183900-47183922 10:47183939-47183961
Sequence CCCTGGAGCCAAGGAGCCAGGGG CTCTGTGGTTGGAGGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 53, 4: 590} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!