ID: 1067564579_1067564590

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1067564579 1067564590
Species Human (GRCh38) Human (GRCh38)
Location 10:47327294-47327316 10:47327325-47327347
Sequence CCAGGGCCTCTCCCCGTGGTTGA TTTATTTAAGAAAAAGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 140} {0: 1, 1: 1, 2: 2, 3: 61, 4: 682}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!