ID: 1067564579_1067564592

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1067564579 1067564592
Species Human (GRCh38) Human (GRCh38)
Location 10:47327294-47327316 10:47327329-47327351
Sequence CCAGGGCCTCTCCCCGTGGTTGA TTTAAGAAAAAGTGGGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 140} {0: 1, 1: 0, 2: 9, 3: 68, 4: 639}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!