ID: 1067569566_1067569576

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1067569566 1067569576
Species Human (GRCh38) Human (GRCh38)
Location 10:47361434-47361456 10:47361483-47361505
Sequence CCGGCCTGGGGGCTACTCTGGCC TCTCCGTGCTCACAGGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!