ID: 1067600872_1067600874

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1067600872 1067600874
Species Human (GRCh38) Human (GRCh38)
Location 10:47597943-47597965 10:47597960-47597982
Sequence CCTGAATAGCCAAAGCAATCTTA ATCTTAAGCTAAAAGAACAAAGG
Strand - +
Off-target summary {0: 50, 1: 453, 2: 2106, 3: 4065, 4: 7020} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!