ID: 1067634392_1067634402

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1067634392 1067634402
Species Human (GRCh38) Human (GRCh38)
Location 10:47991634-47991656 10:47991674-47991696
Sequence CCCAACACCATGCAGGAACCCAA ACTTACCCAGGCTTTCCACCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 11, 4: 200} {0: 2, 1: 1, 2: 0, 3: 8, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!