ID: 1067678282_1067678285

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1067678282 1067678285
Species Human (GRCh38) Human (GRCh38)
Location 10:48406354-48406376 10:48406370-48406392
Sequence CCATGGCAGTGGTGGTGTTGCCT GTTGCCTTAGTTTTTCCTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 20, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!