ID: 1067682170_1067682177

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1067682170 1067682177
Species Human (GRCh38) Human (GRCh38)
Location 10:48448180-48448202 10:48448202-48448224
Sequence CCACACATCTCCAGTCCCCAGCC CCCTGACTCTCCCCCACTACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 24, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!