ID: 1067682745_1067682754

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1067682745 1067682754
Species Human (GRCh38) Human (GRCh38)
Location 10:48450865-48450887 10:48450884-48450906
Sequence CCTTCTTCCCAGGGCTGCACCGG CCGGCTCCCCGGCCCCGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 279} {0: 1, 1: 0, 2: 0, 3: 20, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!