ID: 1067701469_1067701476

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1067701469 1067701476
Species Human (GRCh38) Human (GRCh38)
Location 10:48576131-48576153 10:48576152-48576174
Sequence CCTATGCCCTACGTCAGAGACTA TATGGGCTCCCCACTGGGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 21, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!