ID: 1067705646_1067705655

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1067705646 1067705655
Species Human (GRCh38) Human (GRCh38)
Location 10:48604870-48604892 10:48604895-48604917
Sequence CCTAGTCGCCCCTCATGTCCTGC GTTCGGGGCCCCGTGGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99} {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!