ID: 1067711746_1067711759

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1067711746 1067711759
Species Human (GRCh38) Human (GRCh38)
Location 10:48656031-48656053 10:48656059-48656081
Sequence CCAGGGCCAGCCGTCTCCTCCCC CGGCCGCCCGGGGCCTGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 565} {0: 1, 1: 0, 2: 0, 3: 26, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!