ID: 1067724892_1067724897

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1067724892 1067724897
Species Human (GRCh38) Human (GRCh38)
Location 10:48762583-48762605 10:48762601-48762623
Sequence CCTCCCAGGATGACCTCTTTAGC TTAGCTGTGGCACCTCAGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!