ID: 1067732532_1067732540

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1067732532 1067732540
Species Human (GRCh38) Human (GRCh38)
Location 10:48822391-48822413 10:48822441-48822463
Sequence CCTCAGCCAAGTGCAGAAGCTGC CTGCTTCACCCAGAAGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 273} {0: 1, 1: 0, 2: 4, 3: 37, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!