ID: 1067805018_1067805023

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1067805018 1067805023
Species Human (GRCh38) Human (GRCh38)
Location 10:49386339-49386361 10:49386372-49386394
Sequence CCTGGCTGTGACTGACAGGAGGC CACAGGCCCAGGTGCAAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 228} {0: 1, 1: 0, 2: 4, 3: 38, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!