ID: 1067834390_1067834396

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1067834390 1067834396
Species Human (GRCh38) Human (GRCh38)
Location 10:49629152-49629174 10:49629165-49629187
Sequence CCTCCTACCCACTGCCTATAAGG GCCTATAAGGTCAGAAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 169} {0: 1, 1: 0, 2: 1, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!