ID: 1067834963_1067834973

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1067834963 1067834973
Species Human (GRCh38) Human (GRCh38)
Location 10:49632780-49632802 10:49632820-49632842
Sequence CCAGGCTGCTTAGCCTGACCCTC CATGAGGCCCACAGGGTTCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!