ID: 1067837691_1067837694

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1067837691 1067837694
Species Human (GRCh38) Human (GRCh38)
Location 10:49651689-49651711 10:49651734-49651756
Sequence CCTGGTTTGTCTTCTGACACTTT ACACCTCAGTGCACTCCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 287} {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!