ID: 1067841049_1067841063

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1067841049 1067841063
Species Human (GRCh38) Human (GRCh38)
Location 10:49679755-49679777 10:49679804-49679826
Sequence CCGGTGGAGCACCACACCTTCCG CTCGCCGCGTGCGCCCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77} {0: 1, 1: 0, 2: 0, 3: 4, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!