ID: 1067841058_1067841063

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1067841058 1067841063
Species Human (GRCh38) Human (GRCh38)
Location 10:49679778-49679800 10:49679804-49679826
Sequence CCTGCAGGGCCTGCAAGGTGGGC CTCGCCGCGTGCGCCCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 296} {0: 1, 1: 0, 2: 0, 3: 4, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!