ID: 1067841264_1067841265

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1067841264 1067841265
Species Human (GRCh38) Human (GRCh38)
Location 10:49681183-49681205 10:49681197-49681219
Sequence CCTAGACAGAGGTGCTGAATCAG CTGAATCAGCTCTGTTGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 310} {0: 1, 1: 0, 2: 1, 3: 24, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!