ID: 1067844457_1067844464

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1067844457 1067844464
Species Human (GRCh38) Human (GRCh38)
Location 10:49708884-49708906 10:49708931-49708953
Sequence CCCACCATCTTCTGAAGTGAACT CAGTGCTTTCGCCCTGCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 360} {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!