ID: 1067894638_1067894640

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1067894638 1067894640
Species Human (GRCh38) Human (GRCh38)
Location 10:50165749-50165771 10:50165773-50165795
Sequence CCAAGCTTATCAGATGATTTTTG CAGAACAAGGACAAGAATTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 71, 4: 545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!