ID: 1067917670_1067917676

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1067917670 1067917676
Species Human (GRCh38) Human (GRCh38)
Location 10:50418273-50418295 10:50418301-50418323
Sequence CCTGGTGCTAGGACAGCGGCGCT GCCCGGCGTCTGGAGCTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58} {0: 1, 1: 0, 2: 1, 3: 17, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!