ID: 1067972393_1067972396

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1067972393 1067972396
Species Human (GRCh38) Human (GRCh38)
Location 10:50987668-50987690 10:50987696-50987718
Sequence CCAGTTTTTCACAGGTATTGCCA TACAACCACAGCAAGTATTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!