ID: 1068024830_1068024832

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1068024830 1068024832
Species Human (GRCh38) Human (GRCh38)
Location 10:51629743-51629765 10:51629770-51629792
Sequence CCTGGCTTATTAACAAGTGGGTC ATCCATTCCTTTCCAGTTCGCGG
Strand - +
Off-target summary No data {0: 1, 1: 8, 2: 18, 3: 27, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!