ID: 1068025977_1068025982

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1068025977 1068025982
Species Human (GRCh38) Human (GRCh38)
Location 10:51644690-51644712 10:51644733-51644755
Sequence CCTTTCAGAAGGAAATAGTGTTT CTAGGGTTGTCCATTGCTACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 29, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!