ID: 1068037654_1068037655

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1068037654 1068037655
Species Human (GRCh38) Human (GRCh38)
Location 10:51781333-51781355 10:51781356-51781378
Sequence CCATTGGTTACAAAGCTTTCGTG TTATGTTGTCATTTTAAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 58, 4: 613}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!