ID: 1068171832_1068171835

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1068171832 1068171835
Species Human (GRCh38) Human (GRCh38)
Location 10:53404225-53404247 10:53404243-53404265
Sequence CCCAGAGGAGCAGCAGGATTCAC TTCACAGTAATCTGGCCCTCAGG
Strand - +
Off-target summary {0: 9, 1: 20, 2: 28, 3: 54, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!