ID: 1068196738_1068196747

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1068196738 1068196747
Species Human (GRCh38) Human (GRCh38)
Location 10:53727022-53727044 10:53727058-53727080
Sequence CCGCCCCTGGCTGAACTCCCCTT TCTTCTCTGTTTCTCTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 9, 3: 54, 4: 361} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!