ID: 1068207050_1068207055

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1068207050 1068207055
Species Human (GRCh38) Human (GRCh38)
Location 10:53868974-53868996 10:53869001-53869023
Sequence CCTGGCTAATTCTTTGTAGACAC TCTCGCTATGTTGCCTGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 217, 3: 744, 4: 1341} {0: 26, 1: 524, 2: 5991, 3: 48877, 4: 159199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!