ID: 1068513787_1068513791

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1068513787 1068513791
Species Human (GRCh38) Human (GRCh38)
Location 10:58000660-58000682 10:58000674-58000696
Sequence CCTCACACGTGCATAAGAAAGAG AAGAAAGAGGAAAAGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!