ID: 1068528768_1068528778

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1068528768 1068528778
Species Human (GRCh38) Human (GRCh38)
Location 10:58161773-58161795 10:58161796-58161818
Sequence CCCACCCCCTTCATTTTACAAAT GAGGAAACTAAGGCCTAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 134, 3: 1006, 4: 4119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!