ID: 1068586304_1068586312

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1068586304 1068586312
Species Human (GRCh38) Human (GRCh38)
Location 10:58803147-58803169 10:58803199-58803221
Sequence CCAGGGAGTGAGCGCGCTGCAGA AAAGGGCCCACCTTGCTCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110} {0: 1, 1: 0, 2: 2, 3: 16, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!