ID: 1068775462_1068775468

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1068775462 1068775468
Species Human (GRCh38) Human (GRCh38)
Location 10:60863781-60863803 10:60863806-60863828
Sequence CCTCGGCCTCCCAAAGTGCTGGA CACAGGCATGATCCACTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 91, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!