ID: 1068775783_1068775786

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1068775783 1068775786
Species Human (GRCh38) Human (GRCh38)
Location 10:60866286-60866308 10:60866316-60866338
Sequence CCATGGACTAGATGCACACATTG GCTGGATTTCCAGAACAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!