ID: 1068878214_1068878221

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1068878214 1068878221
Species Human (GRCh38) Human (GRCh38)
Location 10:62020362-62020384 10:62020405-62020427
Sequence CCCTCCCCCATCTGTGTTTAAAA GAGTCTGTTTGATCAATAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 380} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!