ID: 1068923541_1068923543

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1068923541 1068923543
Species Human (GRCh38) Human (GRCh38)
Location 10:62511239-62511261 10:62511253-62511275
Sequence CCAGTGTGAGTTTTCTGAATGTT CTGAATGTTGAAATGGAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 39, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!