ID: 1068955623_1068955637

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1068955623 1068955637
Species Human (GRCh38) Human (GRCh38)
Location 10:62817160-62817182 10:62817190-62817212
Sequence CCTTCCTCTGCCCGCGCGCTCCC CTTCAGCTGCTGCGCGGAGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!