ID: 1068965820_1068965825

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1068965820 1068965825
Species Human (GRCh38) Human (GRCh38)
Location 10:62911329-62911351 10:62911375-62911397
Sequence CCCTGCTTCCTTCACTCACTCTA AAAAATGCTTGCAACCCCAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!