ID: 1068983784_1068983793

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1068983784 1068983793
Species Human (GRCh38) Human (GRCh38)
Location 10:63088496-63088518 10:63088547-63088569
Sequence CCAGCATCTCCACCTTCAGCTGT GCACCTCCATGGAGCACTGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!