ID: 1069022359_1069022368

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1069022359 1069022368
Species Human (GRCh38) Human (GRCh38)
Location 10:63503238-63503260 10:63503256-63503278
Sequence CCCTAACTAAAATTGTAGGTTTT GTTTTTTAGGGGTTTTTGGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!