ID: 1069049632_1069049643

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1069049632 1069049643
Species Human (GRCh38) Human (GRCh38)
Location 10:63778935-63778957 10:63778961-63778983
Sequence CCATCCCACCCCCACCCCATTAT AAAACTGTCTTCCACAAAACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!