ID: 1069049639_1069049647

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1069049639 1069049647
Species Human (GRCh38) Human (GRCh38)
Location 10:63778946-63778968 10:63778983-63779005
Sequence CCACCCCATTATGGAAAAACTGT GTCTCTGGTGCCAAAAAGGTTGG
Strand - +
Off-target summary No data {0: 72, 1: 1078, 2: 1756, 3: 1387, 4: 967}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!