ID: 1069049642_1069049646

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1069049642 1069049646
Species Human (GRCh38) Human (GRCh38)
Location 10:63778951-63778973 10:63778979-63779001
Sequence CCATTATGGAAAAACTGTCTTCC ACTGGTCTCTGGTGCCAAAAAGG
Strand - +
Off-target summary No data {0: 39, 1: 472, 2: 900, 3: 1308, 4: 1244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!